SubtiWiki SubtiWiki
yusR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yusR
168

similar to 3-oxoacyl- acyl-carrier protein reductase

locus
BSU_32900
Molecular weight
13.34 kDa
pI
8.65
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yusR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
3,377,019  3,377,408
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|2HQ1] (from Clostridium Thermocellum 37% identity)
Expression and Regulation
Operons
genes
[gene|652A1CC7F6D33E2C9032E557FAF34B5A828CD441|yusS]-[gene|6A16E8F87DA1D5835DFCD5803B11D0E004E6F4FE|yusR]-[gene|877C25D538BAF1132290BAF7FBB2E7921B51266A|yusQ]
description
[pubmed|22383849]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|652A1CC7F6D33E2C9032E557FAF34B5A828CD441|yusS]->[gene|877C25D538BAF1132290BAF7FBB2E7921B51266A|yusQ]

2021-07-01 08:17:18

Bzhu

2

8b089ba1a8819ac174d944b1a1e096e7f9f1f735

2E6C449E38DB1BD87B6AF2161ED03F601CC1E5AE

Biological materials
Mutant
MGNA-B597 (yusR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1596 NBRP B. subtilis, Japan]
BKE32900 ([gene|6A16E8F87DA1D5835DFCD5803B11D0E004E6F4FE|yusR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATTGACGGCATACAGCT,  downstream forward: _UP4_CTGTAAAGAAAGGGATGCGG
BKK32900 ([gene|6A16E8F87DA1D5835DFCD5803B11D0E004E6F4FE|yusR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATTGACGGCATACAGCT,  downstream forward: _UP4_CTGTAAAGAAAGGGATGCGG

6A16E8F87DA1D5835DFCD5803B11D0E004E6F4FE

Page visits: 734

Time of last update: 2021-08-24 08:44:22

Author of last update: Jstuelk