SubtiWiki SubtiWiki
ytrA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ytrA
168

transcriptional repressor, [wiki|GntR family], control of cell envelope stress responses in response to ramoplanin

locus
BSU_30460
Molecular weight
14.55 kDa
pI
8.09
Protein length
Gene length
function
control of cell envelope stress responses
product
transcriptional repressor ([wiki|GntR family])
essential
no
synonyms
ytrA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1725

This gene is a member of the following regulons

Gene
Coordinates
3,118,847  3,119,239
Phenotypes of a mutant
loss of [wiki|genetic competence] due to overexpression of the [gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF] operon [pubmed|33897624,28189581]
reduced sporulation efficiency [pubmed|28189581]
increased cell wall thickness due to overexpression of the [gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF] operon [pubmed|33897624]
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 10-78) (according to UniProt)
Structure
[PDB|3NEU] (similar protein from ''Listeria innocua'', 41% identity)
Expression and Regulation
Operons
genes
[gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]
description
[Pubmed|10986249,21856850]
regulation
expressed early in the stationary phase [Pubmed|10986249]
regulatory mechanism
[protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]: repression, [Pubmed|10986249,21856850], in [regulon|protein:6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]→[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]

2021-10-17 01:36:32

Jstuelk

13

511c9f88e4f29ce72433096dbf0fd3dc5c038eeb

AE29C5AEECDD6994F28E6275F3C275A0539AF619

Biological materials
Mutant
GP2641 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::''spc''), available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
GP2647 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::''ermC''), available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
MGNA-A138 (ytrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/138 NBRP B. subtilis, Japan]
BKE30460 ([gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT,  downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
BKK30460 ([gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT,  downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
References
10986249,12399512,23504016,21856850,28189581,33897624

6A074CE9AD98A2751A216A2EA8156ACE6FFC7280

Page visits: 2262

Time of last update: 2021-10-20 08:40:12

Author of last update: Jstuelk