SubtiWiki SubtiWiki
senS
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

senS
168

transcriptional regulator of extracellular enzyme genes

locus
BSU_08810
Molecular weight
8.50 kDa
pI
10.55
Protein length
Gene length
function
regulation of extracellular enzyme genes
product
transcriptional regulator
essential
no
synonyms
senS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
959,290  959,508
Expression and Regulation
Operons
genes
[gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]
description
[Pubmed|2108127]
Open in new tab

[gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]

2021-07-16 22:25:12

ghost

2

5c710d3ff51eba5c4ff28a5ee78770d5580b22b8

78499AB54B90CDE177895CE0F4FC61845376C539

Biological materials
Mutant
BKE08810 ([gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT,  downstream forward: _UP4_TGACTACAACGGGTTTTTGC
BKK08810 ([gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT,  downstream forward: _UP4_TGACTACAACGGGTTTTTGC
References
1479343,2108127,16321961

69D55899C7CE30A282AF6011527FAD55A76CDBDA

Page visits: 1073

Time of last update: 2021-08-26 10:05:20

Author of last update: Jstuelk