SubtiWiki SubtiWiki
yojI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yojI
168

similar to multidrug efflux transporters

locus
BSU_19440
Molecular weight
49.09 kDa
pI
9.78
Protein length
Gene length
function
unknown
product
putative multidrug exporter
essential
no
synonyms
yojI, norM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0534

This gene is a member of the following regulons

Gene
Coordinates
2,119,393  2,120,751
The protein
Protein family
[wiki|MOP exporter family]
[wiki|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (according to UniProt)
Structure
[PDB|3MKT] (multidrug exporter from Vibrio cholerae, 37% identity) [pubmed|20861838]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]-[gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]
description
[Pubmed|22383849]
Open in new tab

[gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]→[gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]

2021-08-21 05:05:42

Jstuelk

4

6289b44b0b1685e157c9b387b32516b641f35b50

DFEFEFECC15F15DD51BF4ECD4FD6C40E8101374F

Biological materials
Mutant
MGNA-B427 (yojI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1426 NBRP B. subtilis, Japan]
BKE19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC,  downstream forward: _UP4_CACATTTAAAAGAGGTGATC
BKK19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC,  downstream forward: _UP4_CACATTTAAAAGAGGTGATC
References
Research papers
20861838

692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA

Page visits: 1049

Time of last update: 2021-09-06 20:09:29

Author of last update: Melvin.boenninger