SubtiWiki SubtiWiki
yojI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yojI
168

similar to multidrug efflux transporters

locus
BSU_19440
Molecular weight
49.09 kDa
pI
9.78
Protein length
Gene length
function
unknown
product
putative multidrug exporter
essential
no
synonyms
yojI, norM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0534

This gene is a member of the following regulons

Gene
Coordinates
2,119,393  2,120,751
The protein
Protein family
[wiki|MOP exporter family]
[wiki|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (according to UniProt)
Structure
[PDB|3MKT] (multidrug exporter from Vibrio cholerae, 37% identity) [pubmed|20861838]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]-[gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]
description
[Pubmed|22383849]
Open in new tab

[gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]→[gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]

2021-10-22 16:15:31

Jstuelk

7

6289b44b0b1685e157c9b387b32516b641f35b50

DFEFEFECC15F15DD51BF4ECD4FD6C40E8101374F

Biological materials
Mutant
MGNA-B427 (yojI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1426 NBRP B. subtilis, Japan]
BKE19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC,  downstream forward: _UP4_CACATTTAAAAGAGGTGATC
BKK19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC,  downstream forward: _UP4_CACATTTAAAAGAGGTGATC
References
Research papers
20861838

692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA

Page visits: 1065

Time of last update: 2021-11-30 00:53:10

Author of last update: Melvin.boenninger