SubtiWiki SubtiWiki
ytcC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytcC
168

sporulation protein, similar to lipopolysaccharide N-acetylglucosaminyltransferase

locus
BSU_30880
Molecular weight
46.00 kDa
pI
9.59
Protein length
Gene length
function
lipopolysaccharide biosynthesis
product
sporulation protein
essential
no
synonyms
ytcC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0438

This gene is a member of the following regulons

Gene
Coordinates
3,157,961  3,159,184
The protein
Protein family
[wiki|glycosyltransferase 1 family] (according to UniProt)
[wiki|Glycosyltransferase 4 subfamily] (according to UniProt)
Paralogous protein(s)
[protein|2C17028E7DC755FFC190397AC6509E383C4DF99A|cotSA]
Expression and Regulation
Operons
genes
[gene|59024C05AA0106719C81E45E3B060A6F710B2690|ytcA]-[gene|A51B5F9F86D2F7B690712B9EC181B1C07B312E02|ytcB]-[gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]
description
[Pubmed|22383849]
regulation
expressed late during sporulation in the mother cell ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|sigKC], [wiki|GerE]) [Pubmed|26577401,15699190,12480901]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: repression, [Pubmed|26577401], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|22383849,15699190,12480901], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|59024C05AA0106719C81E45E3B060A6F710B2690|ytcA]→[gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]

2021-08-25 17:30:15

Jstuelk

5

0fd4b4ec2d5d2a00711b534b6ea0edb15aa22353

7C19F03C64E72EC0930CBFC53B593F1821A2DD28

additional information
translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Biological materials
Mutant
MGNA-A278 (ytcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/278 NBRP B. subtilis, Japan]
BKE30880 ([gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATTCCCCCTGATA,  downstream forward: _UP4_TAAAACCTACAGCTCGTGTT
BKK30880 ([gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATTCCCCCTGATA,  downstream forward: _UP4_TAAAACCTACAGCTCGTGTT
References
15699190,12480901,26577401

6911DFB27F6A23F3775DAC5C289EFA163FBD1E56

Page visits: 1478

Time of last update: 2021-08-31 05:36:08

Author of last update: Melvin.boenninger