SubtiWiki SubtiWiki
tagT
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tagT
168

phosphotransferase, attaches teichoic acid, teichuronic acid, or acidic capsular polysaccharide to cell wall peptidoglycan via phosphodiester linkage to N-acteylmuramic acid

locus
BSU_35840
Molecular weight
35.65 kDa
pI
9.55
Protein length
Gene length
function
transfer of anionic cell wall polymers from lipid-linked precursors to peptidoglycan
product
phosphotransferase, responsible for attachment of anionic polymers to peptidoglycan
essential
no
synonyms
tagT, ywtF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1316

This gene is a member of the following regulons

Gene
Coordinates
3,694,239  3,695,207
Phenotypes of a mutant
a ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]'' mutant has no phenoype, the triple ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT] [gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU] [gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]'' mutant is unable to grow under normal conditions [Pubmed|21964069]
The protein
Protein family
LytR/CpsA/Psr (LCP) family (with [protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU] and [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV], according to UniProt)  [Pubmed|19099556]
[wiki|Cofactors]
Mg2+ [Pubmed|29107701,21964069]
Structure
[PDB|6UF5] (aa 46-322) [pubmed|31969390]
[PDB|3MEJ]
[PDB|4DE9] [Pubmed|22432711]
[PDB|6MPS] (bound to LIIa-WTA] [Pubmed|29402087]
[PDB|6MPT] (bound to LI-WTA] [Pubmed|29402087]
Paralogous protein(s)
[protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV], [protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]
[wiki|Localization]
cytoplasmic membrane (with extracytoplasmic catalaytic domain) [Pubmed|21964069]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]
description
[Pubmed|9353933]
regulation
expressed at high salt concentrations ([protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]) [pubmed|18179421]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]

2021-08-28 06:53:58

Jstuelk

1

e37f2a1a08586defe186c389a7abc9eb1d3d7551

36473E1677EDC359D21A858A2B41E52D4D1F0074

genes
[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]-[gene|9730F7C18AC7CA68D144717851A0C261D9647E31|ywtE]
description
[Pubmed|22383849]
regulation
expressed at high salt concentrations ([protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]) [pubmed|18179421]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]→[gene|9730F7C18AC7CA68D144717851A0C261D9647E31|ywtE]

2020-11-06 12:56:32

Jstuelk

0

23d9afb7d569bc46f4d89a080f32c0434f248bde

E687E4D92945FDEC837B783F745A0A7206B4A05E

Biological materials
Mutant
MGNA-A547 (ywtF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/547 NBRP B. subtilis, Japan]
BKE35840 ([gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATCAATACCTCACGT,  downstream forward: _UP4_TAATGAACGGGATGGCGATT
BKK35840 ([gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATCAATACCTCACGT,  downstream forward: _UP4_TAATGAACGGGATGGCGATT
References
Reviews
24024634
Original Publications
18957862,9353933,18179421,19099556,21964069,22432711,29107701,29402087,31969390

68FE85BAA457199D34C9068F38756972CD2D280D

Page visits: 998

Time of last update: 2021-09-16 16:40:47

Author of last update: Jstuelk