SubtiWiki SubtiWiki
glnA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glnA
168

glutamine synthetase, trigger enzyme

locus
BSU_17460
Molecular weight
50.11 kDa
pI
4.87
Protein length
Gene length
function
glutamine biosynthesis, control of [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] and [protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] activity
product
glutamine synthetase, trigger enzyme
essential
no
ec
6.3.1.2
synonyms
glnA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0174

This gene is a member of the following regulons

Gene
Coordinates
1,878,425 1,879,759
Phenotypes of a mutant
auxotrophic for glutamine
The protein
Catalyzed reaction/ biological activity
ATP + L-glutamate + NH4+ --> ADP + H+ + L-glutamine + phosphate (according to UniProt)
Protein family
glutamine synthetase family (single member, according to UniProt)
[wiki|Domains]
glutamate binding flap (aa 300 ... 306: protects unstable intermediates from abberant hydrolysis)
[wiki|Cofactors]
Mg2+
Structure
[PDB|4LNN] (apo-GS) [Pubmed|24158439]
[http://pdb.org/pdb/search/structidSearch.do?structureId=4s0r 4S0R] (the [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]-[protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] complex) [Pubmed|25691471]
[PDB|A general discussion of GS structure]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] on Thr-26, Thr-147, Ser-207, and Thr-286 [Pubmed|20389117]
Effectors of protein activity
feedback inhibition by glutamine, glutamine binds the entrance site for glutamate
activity is inhibited upon interaction with [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] [Pubmed|23535029]
Kinetic information
K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 mol/min/mg
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
GlnA is a homooligomer of 12 subunits
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
description
[Pubmed|8636055]
regulation
expressed in the absence of glutamine ([protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]) [Pubmed|8636055]
the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|8799114], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]: repression, in complex with [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA], in [regulon|protein:641C4BDD9702804642E1753A9C779E80FABB3919|glnR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2906311], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]→[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]

2021-08-10 04:23:25

Jstuelk

2

071583dc6a41a10d9b12ab56cf295c4d4fbfe350

168F5BFAABEE27136E7759E8FF655AA525A270D1

genes
[gene|9F6B78C1932FB56F7F71430DB16BC862A312407B|ynbA]-[gene|14EFA3BF4E5DD5368EF02B0733300CEF7A4E0DC7|ynbB]-[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
description
[Pubmed|22383849]
regulation
the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
Open in new tab

[gene|9F6B78C1932FB56F7F71430DB16BC862A312407B|ynbA]→[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]

2021-07-02 15:33:21

Jstuelk

7

d45811f6bc7bef80a041d78aaa209f36dccdee6a

2408FECBCAE7255480B230470AF58DDA9F084F5A

genes
[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
description
[Pubmed|22383849]
Open in new tab

[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]

2021-08-05 13:15:13

Jstuelk

2

77abfcd1961302cfda46b50781910e5442b5a532

6D069D09F75DA00886F659FD81CC7B55313E5AB8

Biological materials
Mutant
GP247 (''glnA::cat''), available in [wiki|Jrg Stlke]'s lab
BKE17460 (''glnA''::''ermC'') (available at the [http://www.bgsc.org/ BGSC] and in [wiki|Jrg Stlke]'s lab) [pubmed|28189581]
GP2263 (''glnA''::''ermC'') (available in [wiki|Jrg Stlke]'s lab)
BP148 (del([gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA])::''cat''), available in [wiki|Fabian Commichau]'s lab
GP1883 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''ermC''), available in [wiki|Fabian Commichau]'s and [wiki|Jrg Stlke]'s labs
BKE17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
BKK17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
Expression vectors
pGP174: expression/ purification from ''E. coli'', with N-terminal Strep-tag (in [wiki|pGP172]): , available in [wiki|Jrg Stlke]'s lab
pGP177: N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pBQ200], available in [wiki|Jrg Stlke]'s lab
pGP2832: N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pGP380], available in [wiki|Jrg Stlke]'s lab
lacZ fusion
''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-lacZ'': pGP189 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab
Antibody
available in [wiki|Karl Forchhammer]'s lab
labs
[wiki|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]
References
Reviews
10231480,18086213,22625175
Original Publications
19233925,20389117,8799114,18195355,11719184,12139611,2573733,8636055,19233925,16493705,16885465,6141156,2906311,20656908,16055443,25755103,18331450,16547045,8093698,21435182,23535029,24158439,15378759,25691471,26635369,26883633,29794222

68F4E792B99F86AE9E8F06D2200E128937331F5D

Page visits: 23258

Time of last update: 2021-09-14 22:21:31

Author of last update: Jstuelk