SubtiWiki SubtiWiki
ydaC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydaC
168

similar to N-methyltransferase

locus
BSU_04180
Molecular weight
19.95 kDa
pI
9.76
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2226

This gene is a member of the following regulons

Gene
Coordinates
470,957  471,502
The protein
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[PDB|4INE] (N-methyltransferase from Caenorhabditis elegans 31% identity)
Expression and Regulation
Operons
genes
[gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]

2021-08-18 10:27:22

Bzhu

1

6f3dfa132c35dd339e8ab4bc62ca075b7121ad92

F8329B177624CC34F04C4653A1E667DA2AD3C149

Biological materials
Mutant
MGNA-C085 (ydaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2083 NBRP B. subtilis, Japan]
BKE04180 ([gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCGATGACGCCCTTTG,  downstream forward: _UP4_ACATAAAGTGGACGGGCTTC
BKK04180 ([gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCGATGACGCCCTTTG,  downstream forward: _UP4_ACATAAAGTGGACGGGCTTC
References
26577401

671180A1D267729FF59C449B8FDFA9E1990D9F67

Page visits: 696

Time of last update: 2021-08-05 09:38:19

Author of last update: Jstuelk