SubtiWiki SubtiWiki
yneB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yneB
168

similar to resolvase

locus
BSU_17870
Molecular weight
24.59 kDa
pI
6.64
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yneB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1961

This gene is a member of the following regulons

Gene
Coordinates
1,918,742  1,919,395
Phenotypes of a mutant
increased sensitivity to DNA-damaging agents [Pubmed|23728628]
The protein
Protein family
[wiki|site-specific recombinase resolvase family] (according to UniProt)
[wiki|Domains]
[wiki|Resolvase/invertase-type recombinase catalytic domain] (aa 2-147) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]-[gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]-[gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]
description
[Pubmed|12581363]
regulation
induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]) [Pubmed|12581363]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|12581363], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
additional information
YneA is rapidly degraded by extracellular proteases ([protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]) [PubMed|29979679,20400548]
Open in new tab

[gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]→[gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]

2021-10-15 15:40:26

Jstuelk

7

f5114d95348ed4b08aaab3ef4f06db491e6e2102

CDEB8AB847C7CC377F5E2AFD6D3262FCFC93914E

Biological materials
Mutant
BKE17870 ([gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC,  downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
BKK17870 ([gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC,  downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
References
12581363,16267290,23728628

67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A

Page visits: 952

Time of last update: 2021-10-20 10:14:57

Author of last update: Melvin.boenninger