SubtiWiki SubtiWiki
yflN
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yflN
168

similar to metallo-beta-lactamase

locus
BSU_07620
Molecular weight
28.68 kDa
pI
5.07
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yflN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0491

This gene is a member of the following regulons

Gene
Coordinates
835,740  836,534
The protein
Protein family
[wiki|metallo-beta-lactamase superfamily] (according to UniProt)
Structure
[PDB|4AWY] (from Pseudomonas aeruginosa, 25% identity) [pubmed|22664968]
Expression and Regulation
Operons
genes
[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]-[gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]
description
[Pubmed|10972810]
regulation
induced by citrate ([protein|search|CitT]) [Pubmed|10972810]
regulatory mechanism
[protein|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]: activation, [Pubmed|10972810], in [regulon|protein:1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538,10972810], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10972810], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]→[gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]

2021-08-23 19:17:14

ghost

4

3c6c67bfa157ec679e863c4c5073c923f5b317fb

F07F80A43DA7CF191444130E860CCF37E8CB2FF5

Biological materials
Mutant
MGNA-C253 (yflN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2251 NBRP B. subtilis, Japan]
BKE07620 ([gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGACACCTCCGGAAT,  downstream forward: _UP4_TGACACCCGCACCACGCGGG
BKK07620 ([gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGACACCTCCGGAAT,  downstream forward: _UP4_TGACACCCGCACCACGCGGG
References
10972810,22664968

66B9809A77AB15E5C8C8E5A8E26752771AF55E3A

Page visits: 1132

Time of last update: 2021-08-22 07:35:38

Author of last update: Jstuelk