SubtiWiki SubtiWiki
spoVID
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoVID
168

spore coat morphogenetic protein, non-competitive hub during spore encasement, promotes encasement of the spore

locus
BSU_28110
Molecular weight
64.80 kDa
pI
4
Protein length
Gene length
function
spore coat assembly
product
spore coat morphogenetic protein
essential
no
synonyms
spoVID

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5846

This gene is a member of the following regulons

Gene
Coordinates
2,871,022  2,872,749
Phenotypes of a mutant
accumulation of [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA] and [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE] and their dependent proteins at the mother cell proximal spore pole [pubmed|30168214]
The protein
[wiki|Domains]
contains a N-acetylglucosamine-polymer-binding [wiki|LysM domain] (aa 523-567) [Pubmed|18430080]
[wiki|LysM domain] (aa 523-567) (according to UniProt)
[wiki|Localization]
spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA] [Pubmed|22773792,22171814]
Expression and Regulation
Operons
genes
[gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]-[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]
description
[Pubmed|15699190,8449878]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,8449878]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,8449878], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]→[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]

2021-06-04 04:55:42

ghost

2

75576c35a548b943ad54cc70b3b06cc1aa256792

94B9AA3648B3DC3632D745D2108B15329C1C3EEC

Biological materials
Mutant
1A639 ( ''spoVID''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A639&Search=1A639 BGSC]
1S127 ( ''spoVID''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S127&Search=1S127 BGSC]
BKE28110 ([gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTTCATATCCTCCTTTC,  downstream forward: _UP4_TAAACCGTAAGTGATCGGAA
BKK28110 ([gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTTCATATCCTCCTTTC,  downstream forward: _UP4_TAAACCGTAAGTGATCGGAA
labs
[wiki|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
References
Reviews
23202530,18430080
Original Publications
16950916,11325931,12107147,10714986,19775244,15699190,8449878,22773792,22171814,23178679,25259857,19702880,22262582,26187959,30168214,30455281

6698BB092E03BEF48AFD0CBF565410109CD1ABB5

Page visits: 1907

Time of last update: 2021-09-17 18:38:39

Author of last update: Melvin.boenninger