SubtiWiki SubtiWiki
uvrC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

uvrC
168

excinuclease ABC (subunit C), required for transcription-dependent asymmetry in mutation rates of genes in the two orientations

locus
BSU_28490
Molecular weight
69.28 kDa
pI
9.5
Protein length
Gene length
function
DNA repair after UV damage
product
excinuclease ABC (subunit C)
essential
no
ec
null
synonyms
uvrC, uvrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0322

This gene is a member of the following regulons

Gene
Coordinates
2,911,116  2,912,888
The protein
Protein family
uvrC family (single member, according to UniProt)
[wiki|Domains]
[wiki|GIY-YIG-domain] (aa 14-91) (according to UniProt)
[wiki|UVR domain] (aa 196-231) (according to UniProt)
Structure
[PDB|3C65] (5' endonuclease domain, Geobacillus stearothermophilus)
Expression and Regulation
Operons
genes
[gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]
description
[Pubmed|16267290]
regulation
induced upon DNA damage ([protein|search|LexA]) [Pubmed|16267290]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290]], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab

[gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]

2021-07-29 19:33:34

ghost

7

39a47538a8b0e0b69cfbf5e6ab1d9c45e55c5a40

CC9641F068A639F47D9F47652D91917285744335

Biological materials
Mutant
GP3542 (Δ[gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]::kan), available in [wiki|Jörg Stülke]'s lab
BKE28490 ([gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTTACCCTTCCTTAT,  downstream forward: _UP4_TAATGTTGTCCTTTTAAATA
BKK28490 ([gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTTACCCTTCCTTAT,  downstream forward: _UP4_TAATGTTGTCCTTTTAAATA
References
Reviews
16464004,15927210,7801120,22933559
Original Publications
2174442,2559145,16267290,25713353

6624AA675E9E52FFABFF26055F63471AEF881CC5

Page visits: 1436

Time of last update: 2021-09-07 21:47:35

Author of last update: MBenda