SubtiWiki SubtiWiki
licB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

licB
168

lichenan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR] activity

locus
BSU_38590
Molecular weight
10.82 kDa
pI
6.31
Protein length
Gene length
function
lichenan uptake and phosphorylation, control of LicR activity
product
lichenan-specific [category|SW.1.2.2|PTS], EIIB component
essential
no
ec
2.7.1.69
synonyms
licB, celA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1440

This gene is a member of the following regulons

Gene
Coordinates
3,961,566  3,961,874
The protein
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-3 (aa 1-102) (according to UniProt)
Structure
[PDB|1e2b] (from ''E. coli'', 40% identity) [Pubmed|9041631]
Modification
phosphorylation on Ser-37 [Pubmed|17218307]
Paralogous protein(s)
[protein|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
description
[Pubmed|8990303]
regulation
carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8990303], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]: activation, [Pubmed|8990303], in [regulon|protein:E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8990303], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]→[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]

2021-08-20 20:01:57

ghost

3

71a5a6a29188848adbfdb06b462667b975c2c7f8

DF3BDC652C79EB094E8D2D2CE50175B714C16E84

Biological materials
Mutant
BKE38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA,  downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
BKK38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA,  downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
References
19087206,8990303,16872404,10438772,10627040,17218307,8990303,9041631

65FC7F4ED92F747DB7BC5672DCA2D2320A471134

Page visits: 1910

Time of last update: 2021-09-16 01:50:43

Author of last update: Melvin.boenninger