SubtiWiki SubtiWiki
licB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

licB
168

lichenan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR] activity

locus
BSU_38590
Molecular weight
10.82 kDa
pI
6.31
Protein length
Gene length
function
lichenan uptake and phosphorylation, control of LicR activity
product
lichenan-specific [category|SW.1.2.2|PTS], EIIB component
essential
no
ec
2.7.1.69
synonyms
licB, celA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1440

This gene is a member of the following regulons

Gene
Coordinates
3,961,566  3,961,874
The protein
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-3 (aa 1-102) (according to UniProt)
Structure
[PDB|1e2b] (from ''E. coli'', 40% identity) [Pubmed|9041631]
Modification
phosphorylation on Ser-37 [Pubmed|17218307]
Paralogous protein(s)
[protein|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
description
[Pubmed|8990303]
regulation
carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8990303], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]: activation, [Pubmed|8990303], in [regulon|protein:E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8990303], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]→[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]

2021-11-01 11:53:43

ghost

8

71a5a6a29188848adbfdb06b462667b975c2c7f8

DF3BDC652C79EB094E8D2D2CE50175B714C16E84

Biological materials
Mutant
BKE38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA,  downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
BKK38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA,  downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
References
19087206,8990303,16872404,10438772,10627040,17218307,8990303,9041631

65FC7F4ED92F747DB7BC5672DCA2D2320A471134

Page visits: 1935

Time of last update: 2021-11-29 17:27:23

Author of last update: Melvin.boenninger