SubtiWiki SubtiWiki
yesW
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yesW
168

rhamnogalacturonan lyase, generates oligosaccharides

locus
BSU_07050
Molecular weight
67.41 kDa
pI
5.97
Protein length
Gene length
function
utilization of rhamnogalacturonan
product
rhamnogalacturonan lyase, generates oligosaccharides
essential
no
ec
null
synonyms
yesW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
770,234  772,096
The protein
Catalyzed reaction/ biological activity
Endotype eliminative cleavage of L-alpha-rhamnopyranosyl-(1->4)-alpha-D-galactopyranosyluronic acid bonds of rhamnogalacturonan I domains in ramified hairy regions of pectin leaving L-rhamnopyranose at the reducing end and 4-deoxy-4,5-unsaturated D-galactopyranosyluronic acid at the non-reducing end (according to UniPort)
Protein family
polysaccharide lyase 11 family (with [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX], according to UniProt)
[wiki|Domains]
Rhamnose is bound near the active site, but there are also additional rhamnose-binding sites far away from the active site, which possibly function as a carbohydrate-binding region (according to UniProt)
Structure
[PDB|2Z8R]
Paralogous protein(s)
[protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]
[wiki|Localization]
secreted (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
description
[Pubmed|19651770]
regulation
induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
regulatory mechanism
[protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]: activation, [Pubmed|19651770], in [regulon|protein:BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR regulon]
Open in new tab

[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]→[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]

2021-07-15 22:05:25

ghost

5

b91a40fb409b270bcae701238dddb080f2734fb3

A10D4124F5AF6831808648D33C98AF061D3703AA

Biological materials
Mutant
BKE07050 ([gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTGTAAGCGCTTA,  downstream forward: _UP4_TAACTGAAAGGGGGAAGGAA
BKK07050 ([gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTGTAAGCGCTTA,  downstream forward: _UP4_TAACTGAAAGGGGGAAGGAA
References
Reviews
26255130
Original Publications
19651770,17449691,17947240,19193638,16682770

65704140C3B95619D6C0962CB40452D373E2740F

Page visits: 1586

Time of last update: 2021-08-25 10:55:04

Author of last update: Melvin.boenninger