SubtiWiki SubtiWiki
tlrB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tlrB
168

23S rRNA (guanine-N(1)-)-methyltransferase, confers resistance against the macrolide antibiotic tylosin (produced by Streptomyces fradiae)

locus
BSU_39010
Molecular weight
31.32 kDa
pI
8.13
Protein length
Gene length
function
resistance against tylosin
product
23S rRNA (guanine-N(1)-)-methyltransferase
essential
no
synonyms
tlrB, yxjB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2226

This gene is a member of the following regulons

Gene
Coordinates
4,004,288  4,005,136
The protein
Catalyzed reaction/ biological activity
methylates G748 of 23S rRNA in the peptide exit tunnel [pubmed|31719185]
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[PDB|1P91] (from E. coli, 31% identity) [pubmed|14999102]
Expression and Regulation
Operons
genes
[gene|65253C69BAE9679FE4475BFF76BBABBB0FA70C30|tlrB]
description
[Pubmed|10746760]
regulatory mechanism
[protein|4910F1E5BAF274C828FD92C410A1B86FB1D358CE|tlrBL]: attenuation, [pubmed|31719185], in [regulon|protein:4910F1E5BAF274C828FD92C410A1B86FB1D358CE|tlrBL regulon]
additional information
term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yxjB'' [Pubmed|27120414]
Open in new tab

[gene|65253C69BAE9679FE4475BFF76BBABBB0FA70C30|tlrB]

2021-08-18 08:58:37

ghost

1

b192db2aa2838f0f662573e6b1ffb87748578b5a

843C2F2C101F4A5552748F2DEEB08425E90CB186

Biological materials
Mutant
MGNA-B726 (yxjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1725 NBRP B. subtilis, Japan]
1A995 ( ''yxjB''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A995&Search=1A995 BGSC]
BKE39010 ([gene|65253C69BAE9679FE4475BFF76BBABBB0FA70C30|tlrB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAAACACCCCAT,  downstream forward: _UP4_TGAATGGTAGAGGAAAGCTC
BKK39010 ([gene|65253C69BAE9679FE4475BFF76BBABBB0FA70C30|tlrB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAAACACCCCAT,  downstream forward: _UP4_TGAATGGTAGAGGAAAGCTC
References
10746760,27120414,14999102,31719185

65253C69BAE9679FE4475BFF76BBABBB0FA70C30

Page visits: 1137

Time of last update: 2021-09-16 18:43:57

Author of last update: Jstuelk