SubtiWiki SubtiWiki
artQ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

artQ
168

high affinity arginine [wiki|ABC transporter] (permease)

locus
BSU_23970
Molecular weight
23.75 kDa
pI
9.08
Protein length
Gene length
function
arginine uptake
product
high affinity arginine [wiki|ABC transporter] (permease)
essential
no
synonyms
artQ, yqiY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0765

This gene is a member of the following regulons

Gene
Coordinates
2,491,289  2,491,948
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 19-208) (according to UniProt)
Structure
[PDB|4YMS] (from Caldanaerobacter subterraneus, 44% identity) [pubmed|25848002]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]
description
[Pubmed|12107147]
regulation
repressed by casamino acids [Pubmed|12107147]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
Open in new tab

[gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]→[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]

2021-10-07 20:44:28

Jstuelk

4

1f8daf12347a1e5a2524de8bc485482b31efae43

6C46F5E30AD20E2FDEBA2BA2FDE071162025C950

Biological materials
Mutant
GP1689 Δ([gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR])::''mls'', available in [wiki|Jörg Stülke]'s lab
MGNA-C382 ([gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2380 NBRP B. subtilis, Japan]
BKE23970 ([gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCCTTTGTCTCCTTTT,  downstream forward: _UP4_GCTGTAGAAAGGAAGCTGAA
BKK23970 ([gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCCTTTGTCTCCTTTT,  downstream forward: _UP4_GCTGTAGAAAGGAAGCTGAA
References
10092453,12107147,18763711,11423008,25848002

62BD291B91DB0358754957D84A1F3636C247A697

Page visits: 1472

Time of last update: 2021-10-19 09:30:07

Author of last update: Melvin.boenninger