SubtiWiki SubtiWiki
htpX
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

htpX
168

stress-responsive membrane protease

locus
BSU_13490
Molecular weight
32.71 kDa
pI
10.16
Protein length
Gene length
function
quality control of membrane proteins
product
membrane protease
essential
no
synonyms
htpX, ykrL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0501

This gene is a member of the following regulons

Gene
Coordinates
1,414,997  1,415,893
Phenotypes of a mutant
increased sensitivity to membrane protein overproduction [Pubmed|22447908]
increased sensitivity to dissipation of the membrane potential by the addition of valinomycin [Pubmed|22447908]
The protein
Protein family
Peptidase M48B family (with [protein|4B54FF77FD5B6E22D6EF3DBECD9B84C0B5A60E18|yhfN], according to UniProt)
Structure
[PDB|3CQB] (from Vibrio parahaemolyticus, corresponds to aa 71 ... 173, 45% identity)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]
description
[Pubmed|22383849]
regulation
expression is increased due to mutations in ''[protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]'', ''[protein|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]'', ''[protein|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]'', and'' [protein|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]'' [Pubmed|22447908]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|22447908], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
Open in new tab

[gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]

2021-04-07 06:03:25

Jstuelk

1

7ced07f1ccfc0bb9a2a5ea41ab626370f5a2fd2d

0323A4077ED7DC4E1E15C538995287591B28858F

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
MGNA-B316 (ykrL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1315 NBRP B. subtilis, Japan]
BKE13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT,  downstream forward: _UP4_TAATACAAACACATTGTTCC
BKK13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT,  downstream forward: _UP4_TAATACAAACACATTGTTCC
References
Reviews
34410368
Original Publications
22447908,22624725,22383849,23042994,26883633

62B6875301B458F04E3F65717AD3A5925A9C4973

Page visits: 1523

Time of last update: 2021-09-18 21:35:10

Author of last update: Jstuelk