SubtiWiki SubtiWiki
ansB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ansB
168

L-aspartase

locus
BSU_23570
Molecular weight
52.39 kDa
pI
5.69
Protein length
Gene length
function
aspartate degradation
product
L-aspartase
essential
no
ec
4.3.1.1
synonyms
ansB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1027

This gene is a member of the following regulons

Gene
Coordinates
2,454,347  2,455,774
The protein
Catalyzed reaction/ biological activity
L-aspartate --> fumarate + NH4+ (according to UniProt)
Protein family
class-II fumarase/aspartase family (with [protein|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG], according to UniProt)
Structure
[PDB|3R6Q] (from ''Bacillus'' sp. YM55-1, 72% identity, 92% similarity) [Pubmed|21661762]
Paralogous protein(s)
[protein|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]
Expression and Regulation
Operons
genes
[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]
description
[Pubmed|1711029]
regulation
expressed in the presence of asparagine ([protein|146947C974D62BCB282BA3F5B924B35695D75886|ansR]) [Pubmed|11914346]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
[protein|146947C974D62BCB282BA3F5B924B35695D75886|ansR]: repression, [Pubmed|11914346], in [regulon|protein:146947C974D62BCB282BA3F5B924B35695D75886|ansR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1711029], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]→[gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]

2021-10-18 21:08:15

Jstuelk

12

26B0E8E9928B9258DD0E99A3A3CCC1B9E0B8F068

0371500E4D8DAAD3D8BE963EF8C39327F0863D20

genes
[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]-[gene|49DF23B8E19658DB32835B6D23DD21E4BF481B20|mleN]-[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]
description
[Pubmed|22383849]
regulation
''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
Open in new tab

[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]→[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]

2021-10-17 09:33:21

ghost

16

6e6cc6ade2f20ebe93c9f1ed4c2ef4e87af126b1

D7F0E184034763E326DE2841E35068D2FD73DD5D

Biological materials
Mutant
GP1153 (Δ[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]::''ermC'') available in [wiki|Jörg Stülke]'s lab
BKE23570 ([gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATCTTTAACCTTCTTT,  downstream forward: _UP4_TAAAATTTGTATAAAATACA
BKK23570 ([gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATCTTTAACCTTCTTT,  downstream forward: _UP4_TAAAATTTGTATAAAATACA
lacZ fusion
pGP2274 (in [wiki|pAC5]) (GP2961), available in [wiki|Jörg Stülke]'s lab
References
8478318,1711029,1711029,11914346,21219666,22383849

5FAE80F22AEBAE63FC3C872EC651166A65C34DC2

Page visits: 2472

Time of last update: 2021-10-19 08:56:03

Author of last update: Melvin.boenninger