SubtiWiki SubtiWiki
ysnD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ysnD
168

inner spore coat protein

locus
BSU_28320
Molecular weight
11.58 kDa
pI
8.48
Protein length
Gene length
function
protection of the spore
product
spore coat protein
essential
no
ec
null
synonyms
ysnD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,897,788  2,898,123
The protein
[wiki|Localization]
inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA]  [Pubmed|22171814,19933362]
Expression and Regulation
Operons
genes
[gene|5FA26477DF2CE415AB20319853FCB77ABAC71316|ysnD]
description
[Pubmed|12480901]
regulation
expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,15383836,12480901]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: repression, [Pubmed|15383836], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|12480901], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|5FA26477DF2CE415AB20319853FCB77ABAC71316|ysnD]

2021-06-23 00:41:01

ghost

2

b59d6140aa58c5773b81b468ee4045c1f01501d1

BAB879BC217742EB1AA0C60F403F728CCD5235BE

Biological materials
Mutant
MGNA-A993 (ysnD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/993 NBRP B. subtilis, Japan]
BKE28320 ([gene|5FA26477DF2CE415AB20319853FCB77ABAC71316|ysnD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCACCTTTTCTTT,  downstream forward: _UP4_TAAAGAATACCACAAGGGCC
BKK28320 ([gene|5FA26477DF2CE415AB20319853FCB77ABAC71316|ysnD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCACCTTTTCTTT,  downstream forward: _UP4_TAAAGAATACCACAAGGGCC
References
19933362,15699190,15383836,12480901,22171814,25755103

5FA26477DF2CE415AB20319853FCB77ABAC71316

Page visits: 1668

Time of last update: 2021-09-18 20:51:21

Author of last update: Bzhu