SubtiWiki SubtiWiki
yhfA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhfA
168

unknown

locus
BSU_10080
Molecular weight
48.66 kDa
pI
7.28
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhfA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,081,413  1,082,804
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|5EC5DD1844AD995AC1FA6FA76922C77CC514462D|yhfA]-[gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]
description
[Pubmed|22383849]
Open in new tab

[gene|5EC5DD1844AD995AC1FA6FA76922C77CC514462D|yhfA]→[gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]

2020-11-06 12:56:32

Jstuelk

0

18ba246f7b168d3dc6b28c5c6cb8ead3f7bbf76a

A228BFCDA5850ECC48F681076F57ADF95E08D69D

Biological materials
Mutant
MGNA-B501 (yhfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1500 NBRP B. subtilis, Japan]
BKE10080 ([gene|5EC5DD1844AD995AC1FA6FA76922C77CC514462D|yhfA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGATCACTCCTTCCGCT,  downstream forward: _UP4_TAAAACAGCATGAGTTGAAA
BKK10080 ([gene|5EC5DD1844AD995AC1FA6FA76922C77CC514462D|yhfA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGATCACTCCTTCCGCT,  downstream forward: _UP4_TAAAACAGCATGAGTTGAAA

5EC5DD1844AD995AC1FA6FA76922C77CC514462D

Page visits: 935

Time of last update: 2021-07-28 18:49:28

Author of last update: Jstuelk