SubtiWiki SubtiWiki
ycbD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycbD
168

NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase

locus
BSU_02470
Molecular weight
52.25 kDa
pI
4.79
Protein length
Gene length
function
utilization of D-glucarate/galactarate
product
NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase
essential
no
ec
1.2.1.3
synonyms
ycbD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
268,846  270,312
The protein
Catalyzed reaction/ biological activity
2,5-dioxopentanoate + H2O + NADP+ --> 2-oxoglutarate + 2 H+ + NADPH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
NAD+
Structure
[PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 36% identity, 69% similarity)
Paralogous protein(s)
[protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]
Expression and Regulation
Operons
genes
[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
description
[Pubmed|12044674]
regulation
induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
regulatory mechanism
[protein|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]: repression, [Pubmed|12044674], in [regulon|protein:1A65880F68898002EE8774F34EDC47F0243B7273|ycbG regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]→[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]

2021-09-18 05:57:37

ghost

8

a8e395a36da4d417bafa3e16f332fbbf2dcf2e61

24EBFC92FB6A93BD115AC81FF68694FB539EE76E

Biological materials
Mutant
BKE02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG,  downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC
BKK02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG,  downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC
References
12044674,17202142

5B66ADB81AB141982F187B1C5E3A9346AA064DE2

Page visits: 1015

Time of last update: 2021-08-27 14:14:03

Author of last update: Melvin.boenninger