SubtiWiki SubtiWiki
yjdJ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjdJ
168

unknown

locus
BSU_12070
Molecular weight
12.32 kDa
pI
7.89
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yjdJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,278,565  1,278,894
The protein
[wiki|Localization]
membrane (according to UniProt)
Biological materials
Mutant
MGNA-A274 (yjdJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/274 NBRP B. subtilis, Japan]
BKE12070 ([gene|5AD33ED996C3569A27E6E32B8E31DFDD42ECD86E|yjdJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTGTATGACCTCCAA,  downstream forward: _UP4_TGACCCGGTAAAATTCGTTT
BKK12070 ([gene|5AD33ED996C3569A27E6E32B8E31DFDD42ECD86E|yjdJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTGTATGACCTCCAA,  downstream forward: _UP4_TGACCCGGTAAAATTCGTTT
GP2581 ([gene|5AD33ED996C3569A27E6E32B8E31DFDD42ECD86E|yjdJ]::tet comIQ12L) (in DK1042) available in [wiki|Jörg Stülke]'s lab

5AD33ED996C3569A27E6E32B8E31DFDD42ECD86E

Page visits: 837

Time of last update: 2021-08-25 20:37:35

Author of last update: Melvin.boenninger