SubtiWiki SubtiWiki
cysJ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cysJ
168

sulfite reductase (NADPH2) (alpha subunit)

locus
BSU_33440
Molecular weight
67.08 kDa
pI
4.57
Protein length
Gene length
function
sulfite reduction
product
sulfite reductase (NADPH2)
essential
no
synonyms
cysJ, yvgQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0369

This gene is a member of the following regulons

Gene
Coordinates
3,432,339 3,434,156
Phenotypes of a mutant
unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
The protein
Catalyzed reaction/ biological activity
3 H2O + hydrogen sulfide + 3 NADP+ --> 4 H+ + 3 NADPH + sulfite (according to UniProt)
[wiki|Domains]
[wiki|Flavodoxin-like domain] (aa 68-206) (according to UniProt)
[wiki|FAD-binding FR-type domain] (aa 235-454) (according to UniProt)
[wiki|Cofactors]
FMN [Pubmed|21635694]
FAD [Pubmed|21635694]
Structure
[PDB|5GXU] (from Arabidopsis, 32% identity)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]-[gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]
description
[Pubmed|12169591]
regulation
induced by sulfite, sulfate, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
regulatory mechanism
[protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]: activation, [Pubmed|12169591], in [regulon|protein:FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12169591], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]→[gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]

2021-08-12 23:51:58

ghost

1

c76dbdd9ed7d8724551be3211cb722c3be05ea7a

CF5DADBE8969C7BB4BA71235FA6595D0555E76EC

Biological materials
Mutant
1A802 ( ''cysJ''::''kan''), [Pubmed|11445163], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A802&Search=1A802 BGSC]
1A934 ( ''cysJ''::''kan''), [Pubmed|12169591], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A934&Search=1A934 BGSC]
BKE33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
BKK33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
References
15378759,12169591,12107147,11445163,25875741

5A99F57DF0DDF5A129C3702E97621232A8173C22

Page visits: 1431

Time of last update: 2021-09-08 19:41:51

Author of last update: Melvin.boenninger