SubtiWiki SubtiWiki
nucB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nucB
168

[wiki|sporulation]-specific extracellular nuclease

locus
BSU_25750
Molecular weight
14.83 kDa
pI
5.17
Protein length
Gene length
function
DNA degradation after mother cell lysis
product
[wiki|sporulation]-specific extracellular nuclease
essential
no
synonyms
nucB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,652,387  2,652,797
The protein
Structure
[PDB|5OMT] ([protein|search|NucB ]from B. licheniformis, 77% identity, aa 27 - 136) [pubmed|29165717]
[wiki|Localization]
extracellular(signal peptide)(according to UniProt)
Expression and Regulation
Operons
genes
[gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]
description
[Pubmed|7746143]
regulation
expressed during sporulation ([protein|search|SigE]) [Pubmed|7746143]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|7746143], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]

2021-08-26 19:26:54

ghost

3

f3af26ce9af00f2c26aafccc2427ca4e36e31e9f

201A2FACB3E2E0661C29C0E7E9F5D146A3146E22

Biological materials
Mutant
BKE25750 ([gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCCATCCCCCCATACC,  downstream forward: _UP4_TAGTAAAGAAGAGGCTCTTT
BKK25750 ([gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCCATCCCCCCATACC,  downstream forward: _UP4_TAGTAAAGAAGAGGCTCTTT
References
17209033,7746143,29165717

5A3CEDBF81E3263FDB10AC9245D28498C9332D14

Page visits: 1535

Time of last update: 2021-08-27 10:15:12

Author of last update: Jstuelk