SubtiWiki SubtiWiki
ytpB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ytpB
168

tetraprenyl-beta-curcumene synthase, catalyzes the first committed step in C35 terpenoid biosynthesis, salt stress protein

locus
BSU_30500
Molecular weight
42.68 kDa
pI
5.76
Protein length
Gene length
function
C35 terpenoid biosynthesis
product
tetraprenyl-beta-curcumene synthase
essential
no
synonyms
ytpB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,121,538  3,122,641
Phenotypes of a mutant
increased sensitivity to bacitracin, due to the accumulation of heptaprenyl pyrophosphate [Pubmed|24806199]
sensitivity is increased in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB] [gene|34DBBDD76A0B36867E5116FF17391DF70062F745|menA]'' double mutant [Pubmed|24806199]
The protein
Catalyzed reaction/ biological activity
all-trans-heptaprenyl diphosphate --> diphosphate + tetraprenyl-β-curcumene (according to UniProt)
Structure
[PDB|5YO8] (from Bacillus alcalophilus, 50% identity)
Expression and Regulation
Operons
genes
[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]
description
[Pubmed|9387221]
regulation
expressed under conditions of salt stress ([protein|search|SigM]) [http://www.ncbi.nlm.nih.gov/sites/entrez/18179421 Pubmed]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]

2021-10-18 17:08:03

ghost

4

23ddcbad6caff5f39cf360301ad71dc26adb11dc

05895221D119203F060ADC02BC219DB5217090D2

genes
[gene|85A653AF4752A61A39F9C42FC791B2D1444886B1|ytpA]-[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]
description
[Pubmed|18179421]
regulation
expressed under conditions of salt stress ([protein|search|SigM]) [http://www.ncbi.nlm.nih.gov/sites/entrez/18179421 Pubmed]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|85A653AF4752A61A39F9C42FC791B2D1444886B1|ytpA]→[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]

2021-08-30 00:54:30

ghost

13

41a293118d974ba8f373ea72d3616b1f31a4b6e6

6E9DEAC29839E036AE05C9AB94BA1EAB44ED7718

Biological materials
Mutant
MGNA-A164 (ytpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/164 NBRP B. subtilis, Japan]
BKE30500 ([gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACACATGCACCCCCTACT,  downstream forward: _UP4_AAAAATTCAAAGAAAAAAGC
BKK30500 ([gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACACATGCACCCCCTACT,  downstream forward: _UP4_AAAAATTCAAAGAAAAAAGC
References
9387221,18179421,23748782,21627333,24806199

596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E

Page visits: 1698

Time of last update: 2021-10-19 09:21:51

Author of last update: Melvin.boenninger