SubtiWiki SubtiWiki
cysP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cysP
168

sulfate transport in via proton symport

locus
BSU_15580
Molecular weight
36.68 kDa
pI
10.27
Protein length
Gene length
function
sulfate uptake
product
sulfate transport in via proton symport
essential
no
ec
null
synonyms
cysP, ylnA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0306

This gene is a member of the following regulons

Gene
Coordinates
1,631,095  1,632,159
The protein
Protein family
inorganic phosphate transporter (PiT) (TC 2.A.20) family (with [protein|BBFA6A5EE16CE6203AF89573F87678395277C9E8|pit], according to UniProt)
[wiki|Localization]
cell membrane
Expression and Regulation
Operons
genes
[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
description
[Pubmed|11004190]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
S-box: termination, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11004190], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]→[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]

2021-06-26 08:13:24

Jstuelk

5

ee26ed9bec04d4ffdc2deea174a197c7290dfe30

AC610BA23AE4EE98F22EC54E46509E3060BAE285

Biological materials
Mutant
MGNA-B365 (ylnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1364 NBRP B. subtilis, Japan]
BKE15580 ([gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGCTAATTCCATTTTGCAGC,  downstream forward: _UP4_TGATCATTAATCTGAGTAAT
BKK15580 ([gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGCTAATTCCATTTTGCAGC,  downstream forward: _UP4_TGATCATTAATCTGAGTAAT
labs
[[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
References
16267287,18039762,12107147

58A5A7F12664EC38AC21E24C1AD89671D7E648CF

Page visits: 994

Time of last update: 2021-08-01 06:05:39

Author of last update: Melvin.boenninger