SubtiWiki SubtiWiki
melR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

melR
168

transcriptional regulator of the [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] operon

locus
BSU_30260
Molecular weight
38.24 kDa
pI
6.45
Protein length
Gene length
function
regulation of melibiose utilization
product
transcriptional regulator ([wiki|LacI family])
essential
no
synonyms
melR, msmR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1609

This gene is a member of the following regulons

Gene
Coordinates
3,096,782  3,097,816
The protein
Catalyzed reaction/ biological activity
represses the the [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] operon in the absence of melibiose or raffinose [pubmed|31138628]
Protein family
[wiki|LacI family]
[wiki|Domains]
[wiki|HTH lacI-type domain] (aa 2-58) (according to UniProt)
Structure
[PDB|1VPW] (E. coli [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR], 29% identity) [pubmed|9628480]
Expression and Regulation
Operons
genes
[gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
description
[Pubmed|22383849]
regulation
repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]: repression, [pubmed|31138628], in [regulon|protein:58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]→[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]

2021-04-07 02:26:40

ghost

1

a76a3bd8bbf487172d83c078a68b2450f4f95213

AB0F662445BB81BBCFC1971F2E98536D4BBE6D03

Biological materials
Mutant
MGNA-A802 (msmR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/802 NBRP B. subtilis, Japan]
BKE30260 ([gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCCCTCTCATCT,  downstream forward: _UP4_TAAGCAAAGATTCATCACGA
BKK30260 ([gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCCCTCTCATCT,  downstream forward: _UP4_TAAGCAAAGATTCATCACGA
References
22383849,22900538,9628480,31138628

58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5

Page visits: 1384

Time of last update: 2021-09-04 11:09:48

Author of last update: Melvin.boenninger