SubtiWiki SubtiWiki
ykzO

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ykzO
168

unknown, putative pseudogene

locus
BSU_13299
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
ykzO

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Gene
Coordinates
1,395,598  1,395,810
Biological materials
Mutant
BKE13299 ([gene|563C94555A88627C1725E552B818443D278961E9|ykzO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13299 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTTCAATCCCGAAGGCT,  downstream forward: _UP4_TGAGATTACAGAAAAAAACA
BKK13299 ([gene|563C94555A88627C1725E552B818443D278961E9|ykzO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13299 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTTCAATCCCGAAGGCT,  downstream forward: _UP4_TGAGATTACAGAAAAAAACA

563C94555A88627C1725E552B818443D278961E9

Page visits: 617

Time of last update: 2021-07-29 04:06:31

Author of last update: Bzhu