SubtiWiki SubtiWiki
yuzH
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yuzH
168

unknown

locus
BSU_31279
Molecular weight
10.00 kDa
pI
9
Protein length
Gene length
function
unknown
product
unknown
essential
-
synonyms
yuzH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,213,342  3,213,596
Expression and Regulation
Operons
genes
[gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]-[gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]
description
[pubmed|22383849]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15383836], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]->[gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]

2021-07-02 00:52:00

Bzhu

3

6a36d9ebead8f27f8ac513db5ea3cf0de47b924c

97CF83808AB7C45728D5D7AEF660EE65F9A164B0

Biological materials
Mutant
BKE31279 ([gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31279 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCACCTCAGTTT,  downstream forward: _UP4_TCCGGAAAATAGGCGATGGG
BKK31279 ([gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31279 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCACCTCAGTTT,  downstream forward: _UP4_TCCGGAAAATAGGCGATGGG
References
26577401,27766092

561B400C0255AAC2B52ADBBCA05D373E6366CD40

Page visits: 560

Time of last update: 2021-09-07 01:50:35

Author of last update: Bzhu