SubtiWiki SubtiWiki
ykwD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ykwD
168

unknown

locus
BSU_13970
Molecular weight
27.90 kDa
pI
10.11
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykwD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2340

This gene is a member of the following regulons

Gene
Coordinates
1,466,638  1,467,411
The protein
[wiki|Domains]
SCP domain (aa 141-254) (according to UniProt)
Structure
[PDB|4IFA] (from B. anthracis, C-terminal SCP domain of YkwD, aa 138 ... 257, 40% identity)
Expression and Regulation
Operons
genes
[gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]
description
[Pubmed|22383849]
Open in new tab

[gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]

2021-05-07 21:41:18

Jstuelk

1

1892a10b01cc4a413dc3d3161ab653ad8b1f4445

C64B9690B90AD103C708C29CC44DA31E8ACAFB9F

Biological materials
Mutant
MGNA-B334 (ykwD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1333 NBRP B. subtilis, Japan]
BKE13970 ([gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCGTAACCTCCTA,  downstream forward: _UP4_TAATAAAAAAAGATTGCCTG
BKK13970 ([gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCGTAACCTCCTA,  downstream forward: _UP4_TAATAAAAAAAGATTGCCTG
References
20525796

55674E91861B43885F93A754B34886BB428DC60B

Page visits: 713

Time of last update: 2021-10-15 07:19:09

Author of last update: Melvin.boenninger