SubtiWiki SubtiWiki
yjcA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjcA
168

unknown

locus
BSU_11790
Molecular weight
12.90 kDa
pI
4.81
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yjcA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,252,177  1,252,533
The protein
Protein family
UPF0713 family (with [protein|A5238B160277C6440977DE099D3414E2A83ACD81|yngL], according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA]
description
[Pubmed|14523132]
regulation
expressed during sporulation in the mother cell [Pubmed|14523132,15699190]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|14523132,15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA]

2021-04-15 04:18:29

ghost

1

45a4841a24f5f402693ceb6820e509cf3fef6127

5E4A5732050395579FB9E1245A3588E3878B690A

Biological materials
Mutant
MGNA-B294 (yjcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1293 NBRP B. subtilis, Japan]
BKE11790 ([gene|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCGTTCACTCCTTTGCC,  downstream forward: _UP4_TAAGGCGTTACCACCAGCAA
BKK11790 ([gene|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCGTTCACTCCTTTGCC,  downstream forward: _UP4_TAAGGCGTTACCACCAGCAA
References
14523132,15699190

53898B42C9B09C87F2EE23BAA3433E93DC2DA42E

Page visits: 883

Time of last update: 2021-09-01 06:16:45

Author of last update: Melvin.boenninger