SubtiWiki SubtiWiki
cotJB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cotJB
168

polypeptide composition of the spore coat

locus
BSU_06900
Molecular weight
11.61 kDa
pI
5.7
Protein length
Gene length
function
polypeptide composition of the spore coat
product
unknown
essential
no
synonyms
cotJB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5883

This gene is a member of the following regulons

Gene
Coordinates
756,139  756,402
Expression and Regulation
Operons
genes
[gene|65A8D8D94E8E48DA28BA1F7BBB2FDBEB56A5EC72|cotJA]-[gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]-[gene|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]-[gene|E0DCE433B801FCEFF394ABAFE8CA73A0A0133257|yesJ]-[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]
description
[Pubmed|7768848]
regulation
expressed during sporulation ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|7768848]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: activation, [Pubmed|7768848], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|7768848,15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|65A8D8D94E8E48DA28BA1F7BBB2FDBEB56A5EC72|cotJA]→[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]

2021-08-21 13:52:29

ghost

2

7b349dbe13d966b6272f6c4410b36878b8e09df4

02324FDC82FBD729F61B13B10E544A4BA892F20B

Biological materials
Mutant
BKE06900 ([gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCTAGCTGACGATAATATT,  downstream forward: _UP4_CAAGTATAAGGAGGAATGCC
BKK06900 ([gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCTAGCTGACGATAATATT,  downstream forward: _UP4_CAAGTATAAGGAGGAATGCC
References
Reviews
27227299
Original Publications
9364920,7768848,33596081

536079E17C1CC18E77432D8006172D196B896EF8

Page visits: 703

Time of last update: 2021-08-19 07:46:40

Author of last update: Jstuelk