SubtiWiki SubtiWiki
yqzI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqzI
168

unknown

locus
BSU_25850
Molecular weight
5.76 kDa
pI
4.32
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqzI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,660,574  2,660,732
Biological materials
Mutant
BKE25850 ([gene|52C4FC8F59B5A09EFF934E44CC8277714CC3751A|yqzI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATGTTCACCTCAAAAG,  downstream forward: _UP4_TAGATTACGAGGAAGAGATT
BKK25850 ([gene|52C4FC8F59B5A09EFF934E44CC8277714CC3751A|yqzI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATGTTCACCTCAAAAG,  downstream forward: _UP4_TAGATTACGAGGAAGAGATT
References
27766092

52C4FC8F59B5A09EFF934E44CC8277714CC3751A

Page visits: 590

Time of last update: 2021-08-09 06:21:15

Author of last update: Bzhu