SubtiWiki SubtiWiki
epsO
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

epsO
168

similar to pyruvyltransferase, extracellular polysaccharide synthesis

locus
BSU_34220
Molecular weight
37.12 kDa
pI
9.63
Protein length
Gene length
function
biofilm formation
product
unknown
essential
no
synonyms
epsO, yvfF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5039

This gene is a member of the following regulons

Gene
Coordinates
3,514,115  3,515,083
The protein
Protein family
polysaccharide pyruvyl transferase family (with [protein|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI] and [protein|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB], according to UniProt)
Structure
[PDB|5AX7] (from yeast, corresponds to aa 79 ... 303, 30% identity) [pubmed|27194449]
Expression and Regulation
Operons
genes
[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
description
[Pubmed|15661000]
regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab

[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]

2021-09-18 16:57:03

ghost

10

972f8e32dbf02ccc05ec1b86b52f3e7c715bf4da

DAC70A15EA1F43CB18727990D26DF72F59759165

Biological materials
Mutant
MGNA-B608 (yvfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1607 NBRP B. subtilis, Japan]
BKE34220 ([gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGACAGTTTCTGTTTCAGGC,  downstream forward: _UP4_CCTGCTCACATGTGAGCGGA
BKK34220 ([gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGACAGTTTCTGTTTCAGGC,  downstream forward: _UP4_CCTGCTCACATGTGAGCGGA
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
Reviews
20735481
Research papers
27194449
The EAR [wiki|RNA switch]
20374491,20230605

52A47B49B1FB955EE7E3C316B57A2B4134F78480

Page visits: 2057

Time of last update: 2021-09-16 19:17:57

Author of last update: TPed