SubtiWiki SubtiWiki
yeaC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yeaC
168

unknown

locus
BSU_06330
Molecular weight
35.65 kDa
pI
5.45
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yeaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0714

This gene is a member of the following regulons

Gene
Coordinates
688,184  689,146
The protein
Protein family
moxR family (single member, according to UniProt)
Structure
[PDB|2R44] (from Cytophaga hutchinsonii, 41% identity)
Biological materials
Mutant
MGNA-A915 (yeaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/915 NBRP B. subtilis, Japan]
GP1119 (spc), available in [wiki|Jörg Stülke]'s lab
BKE06330 ([gene|52960D4299F66DF41D1971C1FDF74A9438DC54D7|yeaC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCTCCTAGTCA,  downstream forward: _UP4_GTTCAAAGGTCGGCGGTCCG
BKK06330 ([gene|52960D4299F66DF41D1971C1FDF74A9438DC54D7|yeaC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCTCCTAGTCA,  downstream forward: _UP4_GTTCAAAGGTCGGCGGTCCG

52960D4299F66DF41D1971C1FDF74A9438DC54D7

Page visits: 945

Time of last update: 2021-09-13 23:45:26

Author of last update: Melvin.boenninger