SubtiWiki SubtiWiki
yusI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yusI
168

similar to arsenate reductase

locus
BSU_32810
Molecular weight
13.77 kDa
pI
5.59
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yusI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1393

This gene is a member of the following regulons

Gene
Coordinates
3,366,573  3,366,929
The protein
Protein family
ArsC family (with [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR] and [protein|2C6386E9A63F410558D168798D077DF91590F454|spx], according to UniProt)
Structure
[PDB|2M46] (from Staphylococcus aureus, 51% identity)
Expression and Regulation
Operons
genes
[gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]-[gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]-[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]
description
[Pubmed|22383849]
Open in new tab

[gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]→[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]

2021-10-19 20:25:39

Jstuelk

5

7cad883987d1f83ff558362c4d0433757aa19479

21AA0A8075776ECD01FD07F91813709517E166D0

Biological materials
Mutant
MGNA-B593 (yusI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1592 NBRP B. subtilis, Japan]
BKE32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA,  downstream forward: _UP4_TAATGTAAATTTTTTTTGAA
BKK32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA,  downstream forward: _UP4_TAATGTAAATTTTTTTTGAA

5278DD377B110CC14E239B9428F1985B472EEDF5

Page visits: 654

Time of last update: 2021-10-21 11:20:34

Author of last update: Jstuelk