SubtiWiki SubtiWiki
yyaD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yyaD
168

sporulation protein

locus
BSU_40940
Molecular weight
37.57 kDa
pI
7.61
Protein length
Gene length
function
unknown
product
sporulation protein
essential
no
ec
null
synonyms
yyaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3949

This gene is a member of the following regulons

Gene
Coordinates
4,203,424  4,204,440
Expression and Regulation
Operons
genes
[gene|5227AFA9ACFB030DF0BD2ADF8BB00343E7B03907|yyaD]
description
[Pubmed|12662922]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|5227AFA9ACFB030DF0BD2ADF8BB00343E7B03907|yyaD]

2021-06-28 16:42:04

ghost

2

535f4bd95f65d30780135bd5a92db601404054c0

6063BFD1E70D1BB6C3287DAA666E83D673061448

Biological materials
Mutant
MGNA-B871 (yyaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1870 NBRP B. subtilis, Japan]
BKE40940 ([gene|5227AFA9ACFB030DF0BD2ADF8BB00343E7B03907|yyaD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTATCACCTCATAGACAA,  downstream forward: _UP4_TAAGAGGATGTATTTCTTTT
BKK40940 ([gene|5227AFA9ACFB030DF0BD2ADF8BB00343E7B03907|yyaD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTATCACCTCATAGACAA,  downstream forward: _UP4_TAAGAGGATGTATTTCTTTT
References
12662922

5227AFA9ACFB030DF0BD2ADF8BB00343E7B03907

Page visits: 799

Time of last update: 2021-08-22 10:48:24

Author of last update: Bzhu