SubtiWiki SubtiWiki
yqhO

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yqhO
168

unknown

locus
BSU_24510
Molecular weight
32.71 kDa
pI
9.63
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yqhO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1752

This gene is a member of the following regulons

Gene
Coordinates
2,542,439  2,543,314
The protein
[wiki|Domains]
PNPLA domain (aa 5-196) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|51578F3BD1E639463CE84544D0A77CA648D5B76E|yqhO]
description
[pubmed|22383849]
regulation
expressed during [wiki|sporulation] [pubmed|22383849]
Open in new tab

[gene|51578F3BD1E639463CE84544D0A77CA648D5B76E|yqhO]

2021-08-28 06:39:50

Jstuelk

1

a584f6e5e8c9b948216aface6779afe96a3728f1

CE5444EBFC5ED2DC691CA5AB917F3B266AAB4DCB

Biological materials
Mutant
BKE24510 ([gene|51578F3BD1E639463CE84544D0A77CA648D5B76E|yqhO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCCCTCCCCCTC,  downstream forward: _UP4_TATTAAAAAAGCGCTCTGTT
BKK24510 ([gene|51578F3BD1E639463CE84544D0A77CA648D5B76E|yqhO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCCCTCCCCCTC,  downstream forward: _UP4_TATTAAAAAAGCGCTCTGTT

51578F3BD1E639463CE84544D0A77CA648D5B76E

Page visits: 841

Time of last update: 2021-10-06 04:41:59

Author of last update: Melvin.boenninger