SubtiWiki SubtiWiki
yneN
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yneN
168

similar to thiol:disulfide oxidoreductase

locus
BSU_18010
Molecular weight
19.23 kDa
pI
7.86
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yneN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1225

This gene is a member of the following regulons

Gene
Coordinates
1,929,481  1,929,993
The protein
Protein family
[wiki|Thioredoxin family] (according to UniProt)
[wiki|Domains]
[wiki|Thioredoxin domain] (aa 33-170) (according to UniProt)
Structure
[PDB|3ERW] ([protein|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA], 34% identity, aa 42-165) [pubmed|19144642]
Paralogous protein(s)
[protein|F7D869F77E2275110737EF658C58FA1BF742D73F|resA], [protein|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]
description
[Pubmed|22383849]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|12591885], indirect negative regulation by [protein|search|AbrB] [Pubmed|20817675]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12591885], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: repression, (molecular inducer: citrate) [pubmed|10656796] [pubmed|12100558], in [regulon|protein:FE15A41A58A8177280817CA3825764C39185021A|ccpC regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12100558], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1310745], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]→[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]

2021-08-09 11:06:22

ghost

10

11c3575e19719d9d98495e9324e23aee6d346029

4D8AE4853A402B931A1A3D2C11A2983642117BB6

Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation repression, [Pubmed|18697947]
Biological materials
Mutant
MGNA-B392 (yneN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1391 NBRP B. subtilis, Japan]
1A921 ( ''yneN''::''erm''), [Pubmed|15342593], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A921&Search=1A921 BGSC]
BKE18010 ([gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGCCACCTCCGCAGCA,  downstream forward: _UP4_TAGATTCAGTTTTTTTTATA
BKK18010 ([gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGCCACCTCCGCAGCA,  downstream forward: _UP4_TAGATTCAGTTTTTTTTATA
References
22383849,15342593,19144642

50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652

Page visits: 1019

Time of last update: 2021-09-15 05:53:17

Author of last update: Melvin.boenninger