SubtiWiki SubtiWiki
ytrE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytrE
168

[wiki|ABC transporter] (ATP-binding protein)

locus
BSU_30420
Molecular weight
25.31 kDa
pI
5.98
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
ytrE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1136

This gene is a member of the following regulons

Gene
Coordinates
3,115,279  3,115,974
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-231) (according to UniProt)
Structure
[PDB|1L2T] (from Methanocaldococcus jannaschii, 44% identity) [pubmed|12150914]
Paralogous protein(s)
[protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY], [protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
[wiki|Localization]
cell membrane (via [protein|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[protein|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]) [Pubmed|10986249]
Expression and Regulation
Operons
genes
[gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]
description
[Pubmed|10986249,21856850]
regulation
expressed early in the stationary phase [Pubmed|10986249]
regulatory mechanism
[protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]: repression, [Pubmed|10986249,21856850], in [regulon|protein:6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]→[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]

2021-08-26 11:17:30

Jstuelk

10

511c9f88e4f29ce72433096dbf0fd3dc5c038eeb

AE29C5AEECDD6994F28E6275F3C275A0539AF619

Biological materials
Mutant
GP3191 (Δ[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]), available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
MGNA-B537 (ytrE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1536 NBRP B. subtilis, Japan]
BKE30420 ([gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30420 BGSC] and in [wiki|Jörg Stülke]'s lab,  [Pubmed|28189581], upstream reverse: _UP1_ATCAATCATATGTTCTCTCT,  downstream forward: _UP4_GGTGTGCTAAAAGGAGGAAT
BKK30420 ([gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAATCATATGTTCTCTCT,  downstream forward: _UP4_GGTGTGCTAAAAGGAGGAAT
References
10986249,10092453,12399512,22926563,12150914,33450852,33897624

4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB

Page visits: 1737

Time of last update: 2021-09-15 10:25:23

Author of last update: Jstuelk