SubtiWiki SubtiWiki
speE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

speE
168

spermidine synthase

locus
BSU_37500
Molecular weight
31.18 kDa
pI
5.07
Protein length
Gene length
function
spermidine, polyamine biosynthesis
product
spermidine synthase
essential
no
ec
2.5.1.16
synonyms
speE, ywhF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0421

This gene is a member of the following regulons

Gene
Coordinates
3,848,786  3,849,616
Phenotypes of a mutant
inactivation of [gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE] reduces [wiki|sporulation] efficiency to 6% that of wild type cells; delayed entry into [wiki|sporulation] [Pubmed|26735940]
The protein
Catalyzed reaction/ biological activity
putrescine + S-adenosyl 3-(methylsulfanyl)propylamine --> H+ + S-methyl-5'-thioadenosine + spermidine (according to UniProt)
Protein family
spermidine/spermine synthase family (single member, according to UniProt)
[wiki|Domains]
PABS domain (aa 3-236) (according to UniProt)
Structure
[PDB|1IY9]
Expression and Regulation
Operons
genes
[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]-[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]
description
[Pubmed|9723923]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9723923], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]→[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]

2021-07-21 18:38:10

ghost

4

d104eda79cf11caf258634033505649022ae60e1

8EB1957F1B9995E8C2AE0C77629FFC2A59CB591F

additional information
[wiki|Jörg Stülke]'s lab
Biological materials
Mutant
MGNA-A521 (ywhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/521 NBRP B. subtilis, Japan]
BKE37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::erm ), available in the BGSC and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
BKE37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG,  downstream forward: _UP4_TAATGAAGGTATGGCGCAGG
BKK37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG,  downstream forward: _UP4_TAATGAAGGTATGGCGCAGG
References
9723923,26735940

4F3E96C741561746B4E0EEA5AE29DB124C2F7249

Page visits: 2434

Time of last update: 2021-09-17 11:06:14

Author of last update: LKrueger