SubtiWiki SubtiWiki
dsdA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

dsdA
168

D-serine deaminase

locus
BSU_23770
Molecular weight
49.50 kDa
pI
5.55
Protein length
Gene length
function
unknown
product
D-serine deaminase
essential
no
ec
4.3.1.18
synonyms
dsdA, yqjR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3048

This gene is a member of the following regulons

Gene
Coordinates
2,469,580 → 2,470,926
The protein
Catalyzed reaction/ biological activity
D-serine --> NH4+ + pyruvate (according to UniProt)
Protein family
serine/threonine dehydratase family (with [protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA], according to UniProt)
[wiki|Cofactors]
PLP (according to UniProt)
Structure
[PDB|3SS7] (from E. coli, 58% identity) [pubmed|22197591]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]-[gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]-[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]-[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]-[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]
description
[pubmed|22383849]
Open in new tab

[gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]→[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]

2021-10-21 04:14:06

Jstuelk

21

849135de1757b2b3b5c94019b4a82218149cb07b

7866C7C07985979A54369C1D59D36565C48D9B56

Biological materials
Mutant
MGNA-C398 (yqjR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2396 NBRP B. subtilis, Japan]
BKE23770 (Δ[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAACAATCTCTCCCTT,  downstream forward: _UP4_TAAGCAGACAGTGAAAAGGT
BKK23770 (Δ[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAACAATCTCTCCCTT,  downstream forward: _UP4_TAAGCAGACAGTGAAAAGGT
References
3098560,22197591

4E7390A74A8261E8B732E94859E90FE256AD64EE

Page visits: 1027

Time of last update: 2021-10-07 21:38:43

Author of last update: Melvin.boenninger