SubtiWiki SubtiWiki
yvyC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvyC
168

similar to flagellar protein

locus
BSU_35350
Molecular weight
12.89 kDa
pI
4.7
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yvyC, yviH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1334

This gene is a member of the following regulons

Gene
Coordinates
3,634,425  3,634,754
The protein
Structure
[PDB|2HC5] (NMR)
Expression and Regulation
Operons
genes
[gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]-[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-[gene|06FEA5F205B40DD5CF8D9F1328E940D4543F4741|S1350]-[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
description
[pubmed|22383849]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|26577401], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]->[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]

2021-07-20 21:35:44

Jstuelk

4

e3ca620c52dfbad7e213327c6d00bc708a17de60

8A78945BE9E5D0307404BC35D532282B9C61997C

genes
[gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]
description
[Pubmed|8195064]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|8195064], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]→[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]

2021-07-09 06:06:58

ghost

4

9b28a53c95d4115c22d89da24cecd7a8c63ad570

D9CB27CF198941DCE216F3A57E8D073516BD7983

Biological materials
Mutant
BKE35350 ([gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGATCATCCCCTATGC,  downstream forward: _UP4_AAGTAGAATAGGAGTGGTTT
BKK35350 ([gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGATCATCCCCTATGC,  downstream forward: _UP4_AAGTAGAATAGGAGTGGTTT
References
8195064,19455708

4DBF4635B5C5A7541E8F97440D139DAA02547B99

Page visits: 1198

Time of last update: 2021-09-01 19:58:27

Author of last update: Bzhu