SubtiWiki SubtiWiki
tlpB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tlpB
168

membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, acts also as pH sensor, responds to increasing pH as an attractant signal

locus
BSU_31230
Molecular weight
71.36 kDa
pI
4.73
Protein length
Gene length
function
control of chemotaxis, sensing of alkaline environments
product
methyl-accepting chemotaxis protein
essential
no
synonyms
tlpB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0840

This gene is a member of the following regulons

Gene
Coordinates
3,204,067  3,206,055
The protein
[wiki|Domains]
[wiki|Cache domain] (aa 153-228) (according to UniProt)
[wiki|HAMP domain] (aa 203-355) (according to UniProt)
[wiki|Methyl-accepting transducer domain] (aa 374-610) (according to UniProt)
Structure
[PDB|6S1K] (from E. coli, corresponds to aa 285 ... 616, 29% identity) [pubmed|31925330]
Paralogous protein(s)
[protein|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC], [protein|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB], [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|tlpA]
[wiki|Localization]
cell membrane [Pubmed|21515776]
Expression and Regulation
Operons
genes
[gene|4CD44AD8FE68516C84889EAA2137828E06B8A30B|tlpB]
description
[Pubmed|8188684]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|8188684], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
additional information
in minimal medium, TlpB is present with 2,500 +/- 740 molecules per cell [PubMed|21515776]
Open in new tab

[gene|4CD44AD8FE68516C84889EAA2137828E06B8A30B|tlpB]

2020-11-06 12:56:32

ghost

0

394313d0e6d50e4c1582ea29a5cff50bcd95ad05

29F8D84ED677E3E89F8428855CDA213369A3EAC4

Biological materials
Mutant
BKE31230 ([gene|4CD44AD8FE68516C84889EAA2137828E06B8A30B|tlpB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGTTGACTCCTCCT,  downstream forward: _UP4_TAATGAAACGAGAAAGCGGC
BKK31230 ([gene|4CD44AD8FE68516C84889EAA2137828E06B8A30B|tlpB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGTTGACTCCTCCT,  downstream forward: _UP4_TAATGAAACGAGAAAGCGGC
References
Reviews
31792011
Original Publications
8188684,21515776,31685537

4CD44AD8FE68516C84889EAA2137828E06B8A30B

Page visits: 1075

Time of last update: 2021-09-09 14:26:05

Author of last update: Jstuelk