SubtiWiki SubtiWiki
pucG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pucG
168

(S)-ureidoglycine-glyoxylate aminotransferase

locus
BSU_32520
Molecular weight
45.58 kDa
pI
5.42
Protein length
Gene length
function
purine utilization
product
(S)-ureidoglycine-glyoxylate aminotransferase
essential
no
synonyms
pucG, yurG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0075

This gene is a member of the following regulons

Gene
Coordinates
3,341,166  3,342,416
The protein
Catalyzed reaction/ biological activity
transamination between an unstable intermediate ((S)-ureidoglycine) and the end product of purine catabolism (glyoxylate) to yield oxalurate and glycine [Pubmed|20852637]
(S)-2-ureidoglycine + glyoxylate --> glycine + N-carbamoyl-2-oxoglycine (according to UniProt)
Protein family
[wiki|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Cofactors]
PLP
Structure
[PDB|3ISL] [Pubmed|20852637]
Expression and Regulation
Operons
genes
[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]-[gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]
description
[Pubmed|12029039]
regulation
induced in the presence of purine nucleotides (inducer: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
regulatory mechanism
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: activation, [Pubmed|12029039], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12029039], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]→[gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]

2021-09-06 07:48:16

ghost

4

8950b371b49b2d867c39c0645e288618f9712782

C7BE4A3C8762E1DBFB97C41D65DC9339DE1A1137

Biological materials
Mutant
MGNA-A942 (yurG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/942 NBRP B. subtilis, Japan]
BKE32520 ([gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCTGACACAGCCATTCCTC,  downstream forward: _UP4_TAAAGAAAAGCTTGCGGAAC
BKK32520 ([gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCTGACACAGCCATTCCTC,  downstream forward: _UP4_TAAAGAAAAGCTTGCGGAAC
References
11344136,20852637,12029039

4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F

Page visits: 1966

Time of last update: 2021-09-17 12:30:46

Author of last update: Melvin.boenninger