SubtiWiki SubtiWiki
thrC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

thrC
168

threonine synthase, has a minor threonine dehydratase ([protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]) activity

locus
BSU_32250
Molecular weight
37.31 kDa
pI
5.18
Protein length
Gene length
function
biosynthesis of threonine
product
threonine synthase
essential
no
ec
4.2.3.1
synonyms
thrC, thrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0498

This gene is a member of the following regulons

Gene
Coordinates
3,313,770 3,314,828
Phenotypes of a mutant
auxotrophic for threonine [pubmed|32743959]
The protein
Catalyzed reaction/ biological activity
O-phospho-L-homoserine + H2O --> L-threonine + phosphate (according to UniProt)
has additional threonine dehydratase activity [pubmed|27260660]
Protein family
threonine synthase family (single member, according to UniProt)
[wiki|Cofactors]
PLP
Structure
[PDB|6CGQ] (complexed with PLP and PLP-Ala) [pubmed|30830751]
[PDB|6NMX] (complexed with PLP and (Z)-L-2-amino-5-phosphono-3-pentenoic acid (APPA)) [Pubmed|30830751]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]-[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Open in new tab

[gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]→[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]

2021-09-13 05:13:37

Jstuelk

6

679308b32ee019040de1f3917a024913a4a6e24e

A05F487B4319B2D895BE22D03C7D331712EA7165

genes
[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
description
[Pubmed|12107147]
regulation
expressed in the presence of lysine or cysteine ([wiki|ThrR]) [Pubmed|27260660]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|24163341], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]: repression, [Pubmed|27260660], in [regulon|protein:A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR regulon]
Open in new tab

[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]→[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]

2021-08-17 13:52:59

ghost

3

222d0d37f0abf96a1c1d52c80944e1ea90292f91

CF7B5B8FEE827A7467051420FCA74276BC912664

Biological materials
Mutant
GP3030 [gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::''spc'', available in [wiki|Jrg Stlke]'s lab [pubmed|32743959]
1A773 (''thrC''::''cat''), [Pubmed|8973347], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A773&Search=1A773 BGSC] and in [wiki|Jrg Stlke]'s lab
BKE32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
BKK32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
References
12107147,3098560,24163341,15378759,27260660,30830751,4630852,4199513,32743959

4A839F8A53DF75DF01FE410EBD3361759C3B1C86

Page visits: 3088

Time of last update: 2021-09-15 18:16:15

Author of last update: Jstuelk