SubtiWiki SubtiWiki
lytA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

lytA
168

secretion of major autolysin [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]

locus
BSU_35640
Molecular weight
11.09 kDa
pI
4.06
Protein length
Gene length
function
autolysis
product
secretion of major autolysin [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]
essential
no
synonyms
lytA, lppX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,662,789  3,663,097
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]
description
[Pubmed|1357079]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: repression, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|920F91E748EE079FF864011D9052B073567C41E4|slrR]: repression, (in complex with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]) [Pubmed|20351052], in [regulon|protein:920F91E748EE079FF864011D9052B073567C41E4|slrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1357079], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|1357079], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]→[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]

2021-10-12 19:29:26

ghost

7

54809c9955d23e08713713fa70dd86badde4f908

476F8A563F983E1C0C8701E3BACE30BEF16B3A2A

Biological materials
Mutant
1A789 ( ''lytA''::''kan''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A789&Search=1A789 BGSC]
BKE35640 ([gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCACCTCATTAT,  downstream forward: _UP4_TAAGATATAGGGAGGAACCT
BKK35640 ([gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCACCTCATTAT,  downstream forward: _UP4_TAAGATATAGGGAGGAACCT
References
16306698,20351052,1357079,9158733

497C9654DC7514FF738D18E1F083299C43003A4C

Page visits: 3018

Time of last update: 2021-10-18 19:56:05

Author of last update: Melvin.boenninger