SubtiWiki SubtiWiki
resB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

resB
168

part of haem translocase, required for cytochrome c synthesis

locus
BSU_23140
Molecular weight
61.59 kDa
pI
9.47
Protein length
Gene length
function
cytochrome c biogenesis
product
part of the [protein|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[protein|97FE84CF968596AC39D19EE2E43DA625147FD702|resC] haem translocase
essential
no
synonyms
resB, ypxB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1333

This gene is a member of the following regulons

Gene
Coordinates
2,419,179  2,420,807
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
haem-binding protein,  translocation of haem from the cytoplasmic to the extracytoplasmic site of the membrane  [Pubmed|19682263]
[wiki|Localization]
cell membrane  [protein|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[protein|97FE84CF968596AC39D19EE2E43DA625147FD702|resC] [Pubmed|19682263]
Expression and Regulation
Operons
genes
[gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]-[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
description
[Pubmed|22383849]
Open in new tab

[gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]→[gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]

2021-07-16 08:40:43

Jstuelk

5

810e88212899b5da40206112287802e7d6377a71

48F6784365F7D14D1F54674DD0C766FFA75949EC

genes
[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
description
[Pubmed|8631715]
regulation
expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [PubMed|8631715,11222591], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|9988472], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|16825793], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8631715], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]→[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]

2021-07-17 02:33:19

ghost

5

35cf88192088e7d30495dfc1ae6639ee89ad31fe

7099FE353EE3AD6D60FB99016C9CE5D3AB2282C2

Biological materials
Mutant
BKE23140 ([gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGCATTCACATTTGACTT,  downstream forward: _UP4_AAATAGGCGAAAAGGGAGTG
BKK23140 ([gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGCATTCACATTTGACTT,  downstream forward: _UP4_AAATAGGCGAAAAGGGAGTG
References
19682263,10844653,8631715,8631715,11222591,9988472,16825793,28189581

495721E4B8BF6FEC01E62E86339560F90776EED1

Page visits: 2289

Time of last update: 2021-09-16 01:23:17

Author of last update: Jstuelk