SubtiWiki SubtiWiki
vpr
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

vpr
168

minor extracellular serine protease

locus
BSU_38090
Molecular weight
85.42 kDa
pI
5.77
Protein length
Gene length
function
protein degradation
product
minor extracellular serine protease
essential
no
synonyms
vpr, ipa-45r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1404

This gene is a member of the following regulons

Gene
Coordinates
3,907,844  3,910,264
The protein
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
Inhibitor I9 domain (aa 57-142) (according to UniProt)
Peptidase S8 domain (aa 158-579) (according to UniProt)
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]
description
[Pubmed|9353933]
regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|25666135], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|16291680], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [Pubmed|26020636], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|25666135], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]

2021-06-26 01:10:01

ghost

2

716795611eb699fcb1966c2eecfdde9177961236

C9DD489EBFD37E6E87D9A26F88E98B4BA92AE3BD

Biological materials
Mutant
KO7 (''nprE  aprE  epr  mpr  nprB  vpr  bpr''), available as BGSC 1A1133
BKE38090 ([gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTTTCCCCCTTTGT,  downstream forward: _UP4_TAAGAAAAAGCCCTGCCGAT
BKK38090 ([gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTTTCCCCCTTTGT,  downstream forward: _UP4_TAAGAAAAAGCCCTGCCGAT
References
Reviews
34410368
Original Publications
24115457,16291680,16267290,18957862,25666135,26020636,1938892

481AF959FDED9055F33524483101DA9AF2013151

Page visits: 2070

Time of last update: 2021-09-19 11:28:22

Author of last update: Jstuelk