SubtiWiki SubtiWiki
ybcM

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ybcM
168

similar to glucosamine-fructose-6-phosphate aminotransferase

locus
BSU_01900
Molecular weight
11.42 kDa
pI
4.79
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybcM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
213,155  213,469
The protein
Structure
[PDB|4S1W] (from Staphylococcus aureus, 39.5% identity)
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C511 (ybcM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2509 NBRP B. subtilis, Japan]
BKE01900 ([gene|47E3AEE400EC9505C7C7DB07BF172E4FA957F708|ybcM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAGCTTCAGTGCACCT,  downstream forward: _UP4_TAAGATGTTTAACCCCTCTG
BKK01900 ([gene|47E3AEE400EC9505C7C7DB07BF172E4FA957F708|ybcM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAGCTTCAGTGCACCT,  downstream forward: _UP4_TAAGATGTTTAACCCCTCTG
References
17449691

47E3AEE400EC9505C7C7DB07BF172E4FA957F708

Page visits: 803

Time of last update: 2021-10-09 06:27:11

Author of last update: Jstuelk